View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_26 (Length: 309)
Name: NF21107_low_26
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 69 - 295
Target Start/End: Original strand, 36990405 - 36990628
Alignment:
| Q |
69 |
tttaacttacatattcacctggctaagagagtttcttattaattgatttatttactatatgcagaagagacagcttcattacccacagagcattctgtga |
168 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990405 |
tttaacttacat--tcacctggcta-gagagtttcttattaattgatttatttactatatgcagaagagacagcttcattacccacagagcattctgtga |
36990501 |
T |
 |
| Q |
169 |
cgcattagctgaagagaacaacaaagccaacgaaggagtactatcaaacttgcaacaccaaccaatctcaaatctcgtttcttcattacctttaaacccc |
268 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36990502 |
cgcattggctgaagagaacaacaaagccaacgaaggagtactatcaaacttgcaacaccaaccaatctcaaatctcgtttcttcattacctttaaacccc |
36990601 |
T |
 |
| Q |
269 |
attaataaccctcaaattggtggaact |
295 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
36990602 |
attaataaccctcaaatttgtggaact |
36990628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 129 - 191
Target Start/End: Complemental strand, 44150204 - 44150142
Alignment:
| Q |
129 |
gcagaagagacagcttcattacccacagagcattctgtgacgcattagctgaagagaacaaca |
191 |
Q |
| |
|
|||| |||||||| || || |||||||||||||||||||| |||||| ||||||| ||||||| |
|
|
| T |
44150204 |
gcaggagagacagttttataacccacagagcattctgtgatgcattaactgaagaaaacaaca |
44150142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University