View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_33 (Length: 251)
Name: NF21107_low_33
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 38932520 - 38932738
Alignment:
| Q |
14 |
cagagacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgcggttgtcaggttccaatgcatcgat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38932520 |
cagagacaccaacacaacgtagctcagggtgattagcatcccatgtttcagtcagacctgcttctgactcaatgctgttgtcaggttccaatgcatcgat |
38932619 |
T |
|
| Q |
114 |
gctatctagttggcacgactcaatttgatgacgtggtggaagctgtcgtgctgaacataagaagagtaacaaacaaagtgtgatcagaagagattttgtc |
213 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932620 |
gctatctagttggcacgactcactttgatgacgtggtggaagctgtcgtgctgaacagaagaagagtaacaaacaaagtgtgatcagaagagattttgtc |
38932719 |
T |
|
| Q |
214 |
tttgccatgatagctgaac |
232 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
38932720 |
tttgccatgctagctgaac |
38932738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University