View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_40 (Length: 242)
Name: NF21107_low_40
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 28436083 - 28435904
Alignment:
| Q |
1 |
caatttaattgtacagtctttattttagcattttgaatgaagtttattttactt---aatataaaatgttggataatatagagtaaaatagtgagttgaa |
97 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
28436083 |
caatttaattgtagagtctttattttagcattttgaatgaagcttattttactttaaaatataaaatgttggataatatagaggaaaatagtgtgttgaa |
28435984 |
T |
 |
| Q |
98 |
aaatatatatatcagatgttttattaacattattcataagaataaaagagatatattggaaattgatttgatgagcacaaac |
179 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28435983 |
aaatatatat--cagatgttttattaacattattcataagaataaaagagatatattggaaattgatttgatgagcacaaac |
28435904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University