View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_45 (Length: 238)
Name: NF21107_low_45
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_45 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 1959087 - 1958866
Alignment:
| Q |
17 |
aacacaagccatgacaaaataaatacacaaagaaaatgtgagaaagaatgtgtgtatgtgtgtgaagataaatttaaaatatatgttgatacttttctca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1959087 |
aacacaagccatgacaaaataaatacacaaagaaaatgtgagaaagaatgtgtgtatgtgtgtgaagataaatttaaaatatatgttgatacttttctca |
1958988 |
T |
|
| Q |
117 |
tatttattatactagtacaaatttaaggttatgttatgtcactttctattgccttttatttgtaaacattatctttctgctattgttgatagctttttct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
1958987 |
tatttattatactagtacaaatttaaggttatgttatgtcactttctattgccttttatgtgtacacattatctttctgctattgttgatagcttttcct |
1958888 |
T |
|
| Q |
217 |
tgttgcagcttttttacattta |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1958887 |
tgttgcagcttttttacattta |
1958866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 126 - 238
Target Start/End: Original strand, 2024574 - 2024690
Alignment:
| Q |
126 |
tactagtacaaatttaaggttatgttatgtcactttctattgccttttatt----tgtaaacattatctttctgctattgttgatagctttttcttgttg |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2024574 |
tactagtacaaatttaaggttactgtatgtcactttctattgccttctattaatttgtacacattatctttctgctattgttgatagctttttcttgttg |
2024673 |
T |
|
| Q |
222 |
cagcttttttacattta |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
2024674 |
cagcttttttacattta |
2024690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University