View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_47 (Length: 238)
Name: NF21107_low_47
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_47 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 128 - 235
Target Start/End: Original strand, 33596525 - 33596632
Alignment:
| Q |
128 |
tgtggactaccttatgccaacaccaatttatctgtaattccatcggttgtgggatattattgaatctttgctatattactctacatgtggatgaaagtga |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33596525 |
tgtggactaccttatgccaacaccaatttatctgtaattccatcggttgtgggatattattgaatttttgctatattactctacatgtggatgaaagtga |
33596624 |
T |
 |
| Q |
228 |
tgatgtcc |
235 |
Q |
| |
|
|||||||| |
|
|
| T |
33596625 |
tgatgtcc |
33596632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 22 - 130
Target Start/End: Original strand, 33594291 - 33594399
Alignment:
| Q |
22 |
aggggtgtagatttaaggcatgggaatgtgaatgattggatatgaaattaatggaaattttgaaacagctctggtgacttgatgggtcttaatttcttca |
121 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33594291 |
aggggtgtcgatttaaggcatgggaatgtgaatgattggatatgaaattaatggaaattgtgaaacagctctggtgacttgatgggtcttaatttcttca |
33594390 |
T |
 |
| Q |
122 |
tcctcatgt |
130 |
Q |
| |
|
|| |||||| |
|
|
| T |
33594391 |
tcatcatgt |
33594399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University