View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21107_low_49 (Length: 237)
Name: NF21107_low_49
Description: NF21107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21107_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 39 - 221
Target Start/End: Complemental strand, 25986910 - 25986728
Alignment:
| Q |
39 |
attacaggatttggtcgtgattacatttggtactacttctatccgcacttatgttttctcaacatgtgccattttagctagaatgttagcatcctgattt |
138 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
25986910 |
attataggatttggttgtgattacatttggtacttcttctatctgcacttatgttttctcaacaagtgccattttaggtcgaatgttagcatcctgattt |
25986811 |
T |
 |
| Q |
139 |
ttatacttagcttggtgtaatggtagaagggatatgtaacatatgcttggtgtaatggtagaaggatatgtgacttatacttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25986810 |
ttatacttagcttggtgtaatggtagaagggatatgtaacatatgcttggtgtaatggtagaaggatatgtgacttatacttg |
25986728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 204
Target Start/End: Complemental strand, 25986766 - 25986711
Alignment:
| Q |
148 |
gcttggtgtaatggtagaagggatatgtaacatatgcttggtgtaatggtagaagga |
204 |
Q |
| |
|
||||||||||||||||||||| |||||| || ||| ||||||||||||||||||||| |
|
|
| T |
25986766 |
gcttggtgtaatggtagaagg-atatgtgacttatacttggtgtaatggtagaagga |
25986711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University