View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21108_high_14 (Length: 228)
Name: NF21108_high_14
Description: NF21108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21108_high_14 |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0016 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 216
Target Start/End: Original strand, 48553 - 48750
Alignment:
| Q |
18 |
tctcaacaacaagaaattatgttaatatacatgttactatttaacatccatgatttattgaacttaaatagctttcacacatacaaagttttgatgttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48553 |
tctcaacaacaagaaattatgttaatatacatgt-actatttaacatccatgatttattgaacttaaatagctttcacacatacaaagttttgatgttaa |
48651 |
T |
 |
| Q |
118 |
ttagtttgctaaaaatttgttgatgcttgggaatcacttatttgaaaacatattaatatcattttatgaagtaatcagaacatattaatactctgtgct |
216 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
48652 |
ttagtttgcgaaaaatttgttgatgcttgggaatcacttatttgaaaacatattaatatcattttatgaagtaattagaacatattaatactctatgct |
48750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 26 - 216
Target Start/End: Original strand, 79168 - 79358
Alignment:
| Q |
26 |
acaagaaattatgttaatatacatgttactatttaacatccatgatttattgaacttaaatagctttcacacatacaaagttttgatgttaattagtttg |
125 |
Q |
| |
|
|||||||||||||||| |||| ||| || ||||||||||||||||||| ||||||||||||||||||| ||||| |||| |||| ||||||||||||| |
|
|
| T |
79168 |
acaagaaattatgttagtatatatgctagtatttaacatccatgatttcctgaacttaaatagctttcagacatagaaagctttgtagttaattagtttg |
79267 |
T |
 |
| Q |
126 |
ctaaaaatttgttgatgcttgggaatcacttatttgaaaacatattaatatcattttatgaagtaatcagaacatattaatactctgtgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
79268 |
ctaaaaatttgttgatgcttgggaatcaggtatttgaaaacatattaatatcatgttatgaattaatcagaacatattaatactctatgct |
79358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University