View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21108_low_10 (Length: 255)
Name: NF21108_low_10
Description: NF21108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21108_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 2341598 - 2341835
Alignment:
| Q |
1 |
tcgctccttcaacagccaaatccaccgttccagagatctttgctcagtgcaaatcagctgttgcatttaaacagggttggacagaattcaaacatgccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2341598 |
tcgctccttcaacagccaaatccaccgttccagagatctttgctcagtgcaaatcagctgtcgcatttaaaaagggttggacagaattcaaacatgccat |
2341697 |
T |
|
| Q |
101 |
taggtaatcgctagtttcaccgccacggctctaccatgggagttccattgttgagccaacaaacacatcagcaagcaagccctcggcagatgagtcaacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341698 |
taggtaatcgctagtttcaccgccacggctctaccatgggagttccattgttgagccaacaaacacatcagcaagcaagccctcggcagatgagtcaacg |
2341797 |
T |
|
| Q |
201 |
aactccgatgagtccgcaacaaatgaggagcaattcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341798 |
aactccgatgagtccgcaacaaatgaggagcaattcat |
2341835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 130 - 227
Target Start/End: Original strand, 7752639 - 7752736
Alignment:
| Q |
130 |
tctaccatgggagttccattgttgagccaacaaacacatcagcaagcaagccctcggcagatgagtcaacgaactccgatgagtccgcaacaaatgag |
227 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7752639 |
tctaccatgggagtttcatcgttgagccaacaaacacatcagcaagcaagccctcagcaaatgagtcaacgaactccgatgagtccgcaacagatgag |
7752736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 4 - 109
Target Start/End: Original strand, 7751781 - 7751886
Alignment:
| Q |
4 |
ctccttcaacagccaaatccaccgttccagagatctttgctcagtgcaaatcagctgttgcatttaaacagggttggacagaattcaaacatgccattag |
103 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||| || ||||||||||| | |
|
|
| T |
7751781 |
ctccttcaacagcaaaatccacaattccagagatctttgctcagtgcaaatcagctttcacatttaaacggggttggacagaactccaacatgccattgg |
7751880 |
T |
|
| Q |
104 |
gtaatc |
109 |
Q |
| |
|
|||||| |
|
|
| T |
7751881 |
gtaatc |
7751886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University