View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21108_low_12 (Length: 239)
Name: NF21108_low_12
Description: NF21108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21108_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 9360616 - 9360421
Alignment:
| Q |
1 |
tcacaaaaagaaactcaa-tgttacattacataaactccttcnnnnnnnntattacaaatgaattaaatttaaatcttgaaaacacaatttaaatctagc |
99 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || | |
|
|
| T |
9360616 |
tcacaaaaggaaactcaaatgttacattacataaactccttcaaaaaca-tattacaaatgaattaaatttaaatcttgaaaacacaatttaaatgtaac |
9360518 |
T |
 |
| Q |
100 |
atcaagatgtccnnnnnnnnnnnnn------tgattatcaaattttcttttatcattaggaaaggaactcggcatcaatggtttacaacattgtcgt |
190 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
9360517 |
atcaatatgtccaaaaaaaaattaaaaaaaatgattatcaaattttcttttatcattaggaaacgaactcggcatcaatggtttataacactgtcgt |
9360421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University