View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21108_low_14 (Length: 235)
Name: NF21108_low_14
Description: NF21108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21108_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 22200818 - 22201045
Alignment:
| Q |
1 |
agtagttggatcatttggcaattgacggtatttgtggagtttnnnnnnnggaataattgaatgtagnnnnnnngttagtttctaaaatgtcccaatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||| ||||||||||||| |
|
|
| T |
22200818 |
agtagttggatcatttggcaattgacggtatttgtggagtttaaaaaaaggaataattgaacgtagtttttttgttagtttctaaattgtcccaatgatg |
22200917 |
T |
 |
| Q |
101 |
gatgccttgatttttgtatagtgtgacaaattttgtaaattattaactatatcaaggacctaagtatgaagagatggttaatatttggttagtatatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22200918 |
gatgccttgatttttgtatagtgtgacaaattttgtaaattattaactatatcaaggacctaagtatgaagagatggttaatatttggttagtatatgat |
22201017 |
T |
 |
| Q |
201 |
cagttatctgcacaatttggttcatctc |
228 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
22201018 |
cagttgtctgcacaatttggttcatctc |
22201045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University