View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21108_low_19 (Length: 202)
Name: NF21108_low_19
Description: NF21108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21108_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 42821815 - 42821983
Alignment:
| Q |
18 |
tgaacaagagtgaaatggagaaagttttgtccacagttggtgtgttgaaagaggctattcttgaagttgaggatatagctgaggcagcactttatttgag |
117 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||| ||| ||||||||| ||||||| | ||| | || |||||||||||||||||||||||||||||||||| |
|
|
| T |
42821815 |
tgaacaagaatgaagtggagcaagttttgtcctcagctggtgtgttaaaagaggttgttcctaaaattgaggatatagctgaggcagcactttatttgag |
42821914 |
T |
|
| Q |
118 |
tagtgatgagtccaagtttgttaatggagtcaactttgttttggatggaggttatagcaccaccaatat |
186 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42821915 |
tagtgatgagtccaagcttgttaatggagtcaactttgttttggatggaggttatagcaccaccaatat |
42821983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University