View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21108_low_9 (Length: 257)
Name: NF21108_low_9
Description: NF21108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21108_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 3172017 - 3171962
Alignment:
| Q |
1 |
tgatttttatgaaaatgattaatcatgttgattttaaagatgaaatcatcattcca |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3172017 |
tgatttttatgaaaatgattaatcatgttgattttaaagatgaaatcatcattcca |
3171962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 176 - 238
Target Start/End: Complemental strand, 3171848 - 3171786
Alignment:
| Q |
176 |
gtcaccatagtacattttaaccaccaagtttgggaaagattgatgtgtggggtatgagaatat |
238 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| || |||||||||||||| |
|
|
| T |
3171848 |
gtcaccatagtacattttaaccatcaagtttgggatggattgatgcgtagggtatgagaatat |
3171786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University