View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21108_low_9 (Length: 257)

Name: NF21108_low_9
Description: NF21108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21108_low_9
NF21108_low_9
[»] chr4 (2 HSPs)
chr4 (1-56)||(3171962-3172017)
chr4 (176-238)||(3171786-3171848)


Alignment Details
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 3172017 - 3171962
Alignment:
1 tgatttttatgaaaatgattaatcatgttgattttaaagatgaaatcatcattcca 56  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3172017 tgatttttatgaaaatgattaatcatgttgattttaaagatgaaatcatcattcca 3171962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 176 - 238
Target Start/End: Complemental strand, 3171848 - 3171786
Alignment:
176 gtcaccatagtacattttaaccaccaagtttgggaaagattgatgtgtggggtatgagaatat 238  Q
    ||||||||||||||||||||||| |||||||||||  |||||||| || ||||||||||||||    
3171848 gtcaccatagtacattttaaccatcaagtttgggatggattgatgcgtagggtatgagaatat 3171786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University