View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21109_high_4 (Length: 324)
Name: NF21109_high_4
Description: NF21109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21109_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 27 - 76
Target Start/End: Complemental strand, 4638505 - 4638456
Alignment:
| Q |
27 |
tcatcttcttcctctggttcgtttgccattaattttcaaggtcagggttc |
76 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4638505 |
tcatcttcttcctcaggttcgtttgccattaattttcaaggtcagggttc |
4638456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University