View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2110_low_11 (Length: 251)
Name: NF2110_low_11
Description: NF2110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2110_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 135 - 241
Target Start/End: Original strand, 29362051 - 29362157
Alignment:
| Q |
135 |
atgtacgcgtgtacaatgtttcatggtccctttattagtatattacattgaattctgacaccattaaccacgtttttgtcttctctaatatctcctattt |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| | |
|
|
| T |
29362051 |
atgtacgcgtgtacaatgtttcatggtccctttattagtatattacattgaattctgacaccattcaccacgtttttgtcttctctaaattctcctatct |
29362150 |
T |
 |
| Q |
235 |
ttctgtg |
241 |
Q |
| |
|
||||||| |
|
|
| T |
29362151 |
ttctgtg |
29362157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 40 - 94
Target Start/End: Original strand, 29361953 - 29362007
Alignment:
| Q |
40 |
catagcagacacagacagaatgattcaagcacacacggtactcttacgtagtctg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29361953 |
catagcagacacagacagaatgattcaagcacacacggtactcttacgtagtctg |
29362007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University