View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2110_low_12 (Length: 245)
Name: NF2110_low_12
Description: NF2110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2110_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 50014795 - 50015021
Alignment:
| Q |
1 |
accggctttgaaaacttcacttttttcttgcgttgatatcttctgcttccaggttcagcagaactgtatcaattgcggcgtgtgcatgggcaagtatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014795 |
accggctttgaaaacttcacttttttcttgcgttgatatcttctgcttccaggttcagcagaactgtatcaattgcggcgtgtgcatgggcaagtatttt |
50014894 |
T |
 |
| Q |
101 |
tgcgggacatgtaagctctttgatgatgatgtatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatgagccgataataagctaaccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50014895 |
tgcgggacatgtaagctctttgatgatgatgtatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatgagccgataataagctaaccaa |
50014994 |
T |
 |
| Q |
201 |
tatggtcaagttatttgaaacatcaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
50014995 |
tatggtcaagttatttgaaacatcaaa |
50015021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 132 - 180
Target Start/End: Complemental strand, 1780848 - 1780800
Alignment:
| Q |
132 |
tatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatga |
180 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||||||||||||| |
|
|
| T |
1780848 |
tatctaagcagcagtaccattgtaatggctgtggaatttgcaggtatga |
1780800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 180
Target Start/End: Complemental strand, 18050212 - 18050164
Alignment:
| Q |
132 |
tatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatga |
180 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||| |||||||| |
|
|
| T |
18050212 |
tatctaagcagcagtaccattgtaatggctgtggaatttgtaggtatga |
18050164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University