View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2110_low_12 (Length: 245)

Name: NF2110_low_12
Description: NF2110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2110_low_12
NF2110_low_12
[»] chr3 (1 HSPs)
chr3 (1-227)||(50014795-50015021)
[»] chr1 (2 HSPs)
chr1 (132-180)||(1780800-1780848)
chr1 (132-180)||(18050164-18050212)


Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 50014795 - 50015021
Alignment:
1 accggctttgaaaacttcacttttttcttgcgttgatatcttctgcttccaggttcagcagaactgtatcaattgcggcgtgtgcatgggcaagtatttt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50014795 accggctttgaaaacttcacttttttcttgcgttgatatcttctgcttccaggttcagcagaactgtatcaattgcggcgtgtgcatgggcaagtatttt 50014894  T
101 tgcgggacatgtaagctctttgatgatgatgtatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatgagccgataataagctaaccaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50014895 tgcgggacatgtaagctctttgatgatgatgtatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatgagccgataataagctaaccaa 50014994  T
201 tatggtcaagttatttgaaacatcaaa 227  Q
    |||||||||||||||||||||||||||    
50014995 tatggtcaagttatttgaaacatcaaa 50015021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 132 - 180
Target Start/End: Complemental strand, 1780848 - 1780800
Alignment:
132 tatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatga 180  Q
    |||||||||||||||||||||| | ||| ||||||||||||||||||||    
1780848 tatctaagcagcagtaccattgtaatggctgtggaatttgcaggtatga 1780800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 132 - 180
Target Start/End: Complemental strand, 18050212 - 18050164
Alignment:
132 tatctaagcagcagtaccattgcagtggttgtggaatttgcaggtatga 180  Q
    |||||||||||||||||||||| | ||| ||||||||||| ||||||||    
18050212 tatctaagcagcagtaccattgtaatggctgtggaatttgtaggtatga 18050164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University