View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2110_low_13 (Length: 239)
Name: NF2110_low_13
Description: NF2110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2110_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 97 - 222
Target Start/End: Original strand, 21011713 - 21011836
Alignment:
| Q |
97 |
aatcaacttcctttcatagacaagtcctattcaggtcttttactttgattttccggtatcttcttacatactattgaacgagaaaaacttggaaagtgat |
196 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
21011713 |
aatcaacttcccataatagacaagtcctattcaggtctcttactttgattttccggtatctt--tgcatactattgaacgagaaaaacttggaaagtgac |
21011810 |
T |
|
| Q |
197 |
ggtaaaaaacagtgataacctttttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21011811 |
ggtaaaaaacagtgataacctttttc |
21011836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 52
Target Start/End: Original strand, 21011630 - 21011667
Alignment:
| Q |
15 |
tatatatggaaccaaattgaacagtgaaataaaaagca |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21011630 |
tatatatggaaccaaattgaacagtgaaataaaaagca |
21011667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University