View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2110_low_19 (Length: 202)

Name: NF2110_low_19
Description: NF2110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2110_low_19
NF2110_low_19
[»] chr3 (2 HSPs)
chr3 (17-80)||(29513153-29513216)
chr3 (38-131)||(29513093-29513186)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 8e-26; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 17 - 80
Target Start/End: Original strand, 29513153 - 29513216
Alignment:
17 atgaaaattccttttcagtccgtttaactaaccacaccttcaatttagaaattagtcgcacaat 80  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
29513153 atgaaaattccttttcagtccgtttaactaaccagaccttcaatttagaaattagtcgcacaat 29513216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 38 - 131
Target Start/End: Original strand, 29513093 - 29513186
Alignment:
38 gtttaactaaccacaccttcaatttagaaattagtcgcacaattaccacatgttagaaaaatgataattcatgttgtgtccgtttaactaacca 131  Q
    |||||||||||||||||||||||||| ||||| |||||||| ||||| |||||||||||||||| ||||| | ||  |||||||||||||||||    
29513093 gtttaactaaccacaccttcaatttacaaattcgtcgcacatttaccgcatgttagaaaaatgaaaattccttttcagtccgtttaactaacca 29513186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University