View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21110_low_15 (Length: 282)
Name: NF21110_low_15
Description: NF21110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21110_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 259
Target Start/End: Complemental strand, 37769246 - 37769001
Alignment:
| Q |
14 |
gagttgaactcacatctttgcgagatttaccaaccctttttagctggcgagaacatgcgttacaaagacaaaaacaacagaaaaacattgatgtcaaaac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769246 |
gagttgaactcacatctttgcgagatttaccaaccctttttagctggtgagaacatgtgttgcaaagacaaaaacaacagaaaaacattgatgtcaaaac |
37769147 |
T |
 |
| Q |
114 |
aatgacattaactttaccccaacagactgtaactactaagcttatgagaaacaccatgtatattcctaggcaatggaacnnnnnnngattctcaaattgg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37769146 |
aatgacattaactttaccccaacagactgtaactactaagcttatgagaaacaccatgtatattcctaggcaatggaactttttttgattctcaaattgg |
37769047 |
T |
 |
| Q |
214 |
ctttcattagacttggataaactcttcgaattaaacaccggtgagt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769046 |
ctttcattagacttggataaactcttcgaattaaacaccggtgagt |
37769001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University