View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21110_low_18 (Length: 240)
Name: NF21110_low_18
Description: NF21110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21110_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 29284435 - 29284211
Alignment:
| Q |
1 |
ccgatgaaaattagtcactaataatgatggtagaaactccggatgtttataatattannnnnnnn---ggaaagagtacaattttgggatttagtgttag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
29284435 |
ccgatgaaaattagtcactaataatgatggtagaaactccagatgtttataatatttttttttgttttggaaagagtacaatttagggatttagtgttag |
29284336 |
T |
 |
| Q |
98 |
aaattgacatataatcgcgttatatgattggtggaagcaaacaaaattgtactgtcggggactatcatctcaattgaaacttgtggcataagattttgcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29284335 |
aaattgacatataatcgcgttatatgattggtggaagcaaacaaaattgtactgtcggggactatcatctcaattgaaacttgtggcataagattttgcc |
29284236 |
T |
 |
| Q |
198 |
tcttatcactcgtgatgttcgagtt |
222 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
29284235 |
tgttatcactcgtgatgttcgagtt |
29284211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University