View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21110_low_19 (Length: 236)
Name: NF21110_low_19
Description: NF21110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21110_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37769310 - 37769535
Alignment:
| Q |
1 |
ctgggacccaactcacctaaccttttattcgcagc-----tgcaattgcgatcgcaaccaaatcataaagatagttaaaaggggtgctcctaagaataaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769310 |
ctgggacccaactcacctaaccttttattcgcagcgtagctgcaattgcgatcacaaccaaatcataaagatagttaaaaggggtgctcctaagaataaa |
37769409 |
T |
 |
| Q |
96 |
aatttctttagcacaagtggaagggcacaagtttcgtgtgttgttatctattcttcccaattgggaggtagctgagattggaagaaacctgaaacatctg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37769410 |
aatttctttagcacaagtggaagggcacaagtttcgtgtgttgttatctattcttcccaattgggaggtagctgatattggaagaaacctgaaacatctg |
37769509 |
T |
 |
| Q |
196 |
ttcatgtcaaattttcctgctctttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37769510 |
ttcatgtcaaattttcctgctctttt |
37769535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University