View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21110_low_20 (Length: 218)
Name: NF21110_low_20
Description: NF21110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21110_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 201
Target Start/End: Original strand, 10527894 - 10528078
Alignment:
| Q |
20 |
aaattttacaaaaaatcaagcttggagtccatatccatt---ttcttatacacatgttagatatttggttaatctctcaaattgatgtttctctatttta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10527894 |
aaattttacaaaaaatcaagcttggagtccatatccattattttcttatacacatgttagatatttggttaatctctcaaattgatgtttctctattttg |
10527993 |
T |
|
| Q |
117 |
ttatatccaacacaacaggatctgcacctgcagctagctagcaatgtcacaaagacgtccactctcaaacatgaactctagaatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10527994 |
ttatatccaacacaacaggatctgcacctgcagctagctagcaatgtcacaaagacgtccactctcaaacatgaactctagaatt |
10528078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 21 - 181
Target Start/End: Complemental strand, 33227387 - 33227225
Alignment:
| Q |
21 |
aattttacaaaaaatcaagcttggagtccatatccatt---ttcttatacacatgttagatatttggttaatctctcaaattgatgtttctctattttat |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
33227387 |
aatttcacaaaaaatcaagcttggagtccatatccattattttcttatacacatgttagatatt-ggttaatctctcaaattgatgtttctctattttgt |
33227289 |
T |
|
| Q |
118 |
tatatccaacacaacaggatctgcacctgcagctagctagcaatgtcacaaagacgtccactct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33227288 |
tatatccaacacaacaggatctgcacctgcagctagctagcaatgtcacaaagacgtccactct |
33227225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 115
Target Start/End: Complemental strand, 33218463 - 33218405
Alignment:
| Q |
56 |
attttcttatacacatgttagatatttggttaatctctcaaattgatgtttctctatttt |
115 |
Q |
| |
|
||||| |||| |||||||||| |||| |||||||||||||||| ||| |||||||||||| |
|
|
| T |
33218463 |
atttttttatccacatgttagttatt-ggttaatctctcaaatagatttttctctatttt |
33218405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University