View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21111_low_3 (Length: 293)
Name: NF21111_low_3
Description: NF21111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21111_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 30346825 - 30347010
Alignment:
| Q |
20 |
ggaggcacttgaagcagtggtaaaagatggaccgcagaggctagcaaggagaggaaaagcttgccgcgagtatgctgcctcaatgttcacagcaaaaaag |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346825 |
ggaggcacttcaagcagtggtaaaagatggaccacagaggctagcaaggagaggaaaagcttgccgcgagtatgctgcctcaatgttcacagcaaaaaag |
30346924 |
T |
|
| Q |
120 |
atggcattagcatatgagaggttatttctatgtataaaagattctacattttgtatctacccttgaggcttagactagaaatacac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30346925 |
atggcattagcatatgagaggttatttctatgtataaaagattctacattttgtatctacccttgaggcttagactagaaatacac |
30347010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 237 - 272
Target Start/End: Original strand, 30347042 - 30347077
Alignment:
| Q |
237 |
agtacataataaagatgatgaaatctgaaggccatt |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30347042 |
agtacataataaagatgatgaaatctgaaggccatt |
30347077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 187
Target Start/End: Complemental strand, 10840811 - 10840650
Alignment:
| Q |
26 |
acttgaagcagtggtaaaagatggaccgcagaggctagcaaggagaggaaaagcttgccgcgagtatgctgcctcaatgttcacagcaaaaaagatggca |
125 |
Q |
| |
|
||||||| ||| ||||||||||| | ||||||||| |||||| ||||| |||||||| || || || || ||||| || ||||||||||||||| |
|
|
| T |
10840811 |
acttgaacaagttgtaaaagatggtaaggagaggctagaaaggaggggaaatgcttgccgtgaatacgcaaattctatgtttactgcaaaaaagatggca |
10840712 |
T |
|
| Q |
126 |
ttagcatatgagaggttatttctatgtataaaagattctacattttgtatctacccttgagg |
187 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||| ||||||||||| ||| |||||||| |
|
|
| T |
10840711 |
ttagcatatgagagactattcctatgcataaaaagagatacattttgtacctatccttgagg |
10840650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University