View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21112_high_2 (Length: 359)
Name: NF21112_high_2
Description: NF21112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21112_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 56 - 338
Target Start/End: Complemental strand, 34942177 - 34941895
Alignment:
| Q |
56 |
acctgtggctcacagttcaaccgctcaaaccggaacagaacagcggtcaaacccctcaaataaccgaatagttgacagcatcggttcacggtttaaccgg |
155 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34942177 |
acctgtggctcatagttcaaccgctcaaaccggaacagaacagcggtcaaaccactcaaataaccgaatagttgacagcatcggttcacggtttaaccgg |
34942078 |
T |
 |
| Q |
156 |
ttgaactgtatggttcggttccaccatttctgaattctagacctaatagatcattacttgaacttcacttttatgtttatgtcataaggatacaatatgc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34942077 |
ttgaactgtatggttcggttccaccatttctgaattctagacctaatagatcattacttgaacttcacttttatgtttatgtcataaggatacaatatgc |
34941978 |
T |
 |
| Q |
256 |
tacatggaaagaagaatgtcgccaattgtttcctcttgttggaagtggtcgatttatcacatctcctgtaattactgatgatg |
338 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34941977 |
tacatggaaaaaagaatgtcgccaattgtttcctcttgttggaagtggtcgatttatcacatcccctgtaattactgatgatg |
34941895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 248 - 315
Target Start/End: Original strand, 31398521 - 31398588
Alignment:
| Q |
248 |
caatatgctacatggaaagaagaatgtcgccaattgtttcctcttgttggaagtggtcgatttatcac |
315 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
31398521 |
caatatgctgaatggaaggaagaatgtcgccaactgtttcctcttgtaggaagtggtagatttatcac |
31398588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University