View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21112_low_1 (Length: 267)
Name: NF21112_low_1
Description: NF21112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21112_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 140 - 251
Target Start/End: Complemental strand, 629522 - 629411
Alignment:
| Q |
140 |
cttcaactaatggcctctctaattcatcagcagaaccctaatcaaataaagaacagatcaagattaggttaataatgaaatcatgattattataagataa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629522 |
cttcaactaatggcctctctaattcatcagcagaaccctaatcaaataaagaacagatcaagattaggttaataatgaaatcatgattattataagataa |
629423 |
T |
 |
| Q |
240 |
taaagaagatta |
251 |
Q |
| |
|
|||||||||||| |
|
|
| T |
629422 |
taaagaagatta |
629411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 629645 - 629555
Alignment:
| Q |
14 |
gagcttgtccatgtgttcttggagaacgaaaattaacttcattaggataataacacgcaccttcaagatcataatccctagataataatcc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
629645 |
gagcttgtccatgtgttcttggagaacgaaaattaacttcattaggataataacaagcaccttcaagatcataatccctagataataatcc |
629555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University