View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21113_high_13 (Length: 318)
Name: NF21113_high_13
Description: NF21113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21113_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 17 - 301
Target Start/End: Original strand, 5331612 - 5331896
Alignment:
| Q |
17 |
attaattggactcgtgaaaatttgtaaccctttctcagggccaccaaactacagctacagtccacacaattgccctcgtgatgccattcggattggagat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5331612 |
attaattggactcgtgaaaatttgtaaccctttctcagggccaccaaactacagctacagtccacacaattgccctcgtgatgccattcggattggagat |
5331711 |
T |
 |
| Q |
117 |
ttaccaaaagtaagtcacgaaactctcacgctgaatgaatagtcttgtaagattcgacttttctcataggcttaagtcatacctacggtctactagtgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5331712 |
ttaccaaaagtaagtcacgaaactctcacgctaaatgaatagtcttgtaagattcgacttttctcataggcttaagtcataactacggtctactagtgct |
5331811 |
T |
 |
| Q |
217 |
tttcttgagagttaagttacgtaaaaggcggcctatagactttattaaggttcaccattgaataccaatagacgagtgaagctgc |
301 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5331812 |
tttcttgagagttaagttacgtaacgggcggcctatagactttattaaggttcaccattgaataccaatagacgagtgaagctgc |
5331896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University