View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21113_high_21 (Length: 215)
Name: NF21113_high_21
Description: NF21113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21113_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 13 - 177
Target Start/End: Original strand, 9382221 - 9382385
Alignment:
| Q |
13 |
gaagaatatcgaagacaagttggagcttataaatgatgaaaatatcagatgcagtaagtaaaacacaaatctgctcaaccaatgactgatgaactacttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9382221 |
gaagaatatcgaagacaagttggagcttataaataatgaaaatattagatgcagtaagtaaaacacaaatctgctcaaccaatggctgatgaactacttt |
9382320 |
T |
|
| Q |
113 |
ataagctatttgacaactggattgagttaaaagataagaaattggaggcattggatacaaatgag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9382321 |
ataagctatttgacaactggattgagttaaaagataagaaattggaggctttggatacaaatgag |
9382385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University