View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21115_high_4 (Length: 201)

Name: NF21115_high_4
Description: NF21115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21115_high_4
NF21115_high_4
[»] chr6 (1 HSPs)
chr6 (1-189)||(34381829-34382017)


Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 34382017 - 34381829
Alignment:
1 ctcattttctttccctttccctttctctcttctccctgannnnnnncctctacctgtgatagggttatttgtatgtcatcatgagctttgcggcggccta 100  Q
    |||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||| |||||||||||||||||||||||||||||||    
34382017 ctcattttctttccctttccctttctctcttctccctgatttttttcctctacctgtgatagggttatgtgtatgtcatcatgagctttgcggcggccta 34381918  T
101 atccctattgtctggactttttgtgtgggtatttggcatatagtannnnnnngtcgtcttgaattatatgattggtcatagtatatatt 189  Q
    ||||||||||| |||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
34381917 atccctattgtgtggactttttgtgtgggtatttggcatatagtatttttttgtcgtcttgaattatatgattggtcatagtatatatt 34381829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University