View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21115_high_4 (Length: 201)
Name: NF21115_high_4
Description: NF21115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21115_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 34382017 - 34381829
Alignment:
| Q |
1 |
ctcattttctttccctttccctttctctcttctccctgannnnnnncctctacctgtgatagggttatttgtatgtcatcatgagctttgcggcggccta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34382017 |
ctcattttctttccctttccctttctctcttctccctgatttttttcctctacctgtgatagggttatgtgtatgtcatcatgagctttgcggcggccta |
34381918 |
T |
 |
| Q |
101 |
atccctattgtctggactttttgtgtgggtatttggcatatagtannnnnnngtcgtcttgaattatatgattggtcatagtatatatt |
189 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34381917 |
atccctattgtgtggactttttgtgtgggtatttggcatatagtatttttttgtcgtcttgaattatatgattggtcatagtatatatt |
34381829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University