View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21115_low_4 (Length: 244)
Name: NF21115_low_4
Description: NF21115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21115_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 13 - 226
Target Start/End: Complemental strand, 10670941 - 10670729
Alignment:
| Q |
13 |
aatatggtttaatacatgagtcacatgagttttcaactagaggtttgtaaaagttgatggaggtgatattcatcttttgcttctttgattttatttatct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10670941 |
aatatggtttaatacatgagtcacatgagttttcaactagaggtttgtaaaagttgatggagatgatattcatcttttgcttctttggttttatttatct |
10670842 |
T |
|
| Q |
113 |
tctaacacctcaaatgtttgagacatggtttaattttattcaaattttaatctctggnnnnnnnnggttagaggttttatgcatcatgtttgaagagttc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10670841 |
tctaacacctcaaatgtttgagacatggttt-attttattcaaattttaatctctggttttgtttggttagaggttttatgcatcatgtttgaagaattc |
10670743 |
T |
|
| Q |
213 |
ataataaatgtctt |
226 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
10670742 |
aaaataaatgtctt |
10670729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University