View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21116_low_4 (Length: 250)
Name: NF21116_low_4
Description: NF21116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21116_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 66 - 247
Target Start/End: Original strand, 47198939 - 47199120
Alignment:
| Q |
66 |
tttagtttaagcatttatcttttacgctcataattattttcattacattcagtgattgtacttcttcaattattataaatgaaatatttcatttggaatt |
165 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47198939 |
tttagcttaaccatttatcttttacgctcataattattttcattacattcagttattgtacttcttccattattataaatgaaatatttcatttggaatt |
47199038 |
T |
 |
| Q |
166 |
cttcatttgagatccacttttgtaacttttaggagaggtattttcattgagctacaaaaacttcttgaatctgtgctcctcc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
47199039 |
cttcatttgagatccacttttgtaacttttaggagaggtattttcattgagctacaaaaacttcttgaatcagtgttcctcc |
47199120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 47198911 - 47198946
Alignment:
| Q |
1 |
tttagtggattataatagatccttgccatttagctt |
36 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47198911 |
tttagtagattataatagatccttgccatttagctt |
47198946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University