View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21116_low_7 (Length: 237)
Name: NF21116_low_7
Description: NF21116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21116_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 45196197 - 45195977
Alignment:
| Q |
1 |
cagactgccttcacctcaaagaaggattatggaaaaggagagagagaagcacaatgggccgcagctcaacgcacactacatggcttgaatcctccggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45196197 |
cagactgccttcacctcaaagaaggattatggaaaaggagagagagaagcacaatgggccgcagctcaacgcacactacatggcttgaatcctccggaaa |
45196098 |
T |
|
| Q |
101 |
cagatcaagtgttgaatgaatctaacaactacagagaattatctgaacttgcagatcaagcaaagaaacgtgctgaaattgcaaggttaagggagcttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45196097 |
cagatcaagtgttgaatgaatctaacaactacagagaattatctgaacttgcagatcaagcaaagaaacgtgctgaaattgcaaggttaagggagcttca |
45195998 |
T |
|
| Q |
201 |
cacactgaaaggacatgttga |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45195997 |
cacactgaaaggacatgttga |
45195977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 1495454 - 1495396
Alignment:
| Q |
1 |
cagactgccttcacctcaaagaaggattatggaaaaggagagagagaagcacaatgggc |
59 |
Q |
| |
|
|||||||||||||| ||||||| || |||||||||| |||||| |||||||||||||| |
|
|
| T |
1495454 |
cagactgccttcactacaaagaaagactatggaaaagaagagagggaagcacaatgggc |
1495396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University