View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21117_high_10 (Length: 226)
Name: NF21117_high_10
Description: NF21117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21117_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 51105310 - 51105529
Alignment:
| Q |
1 |
caaagaaatctcgtttgtttttcttgccaatgcaactagacaaccaaggacaatgatggtcaaattgttccacacattgatcacatatagcacaatgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51105310 |
caaagaaatctcgtttgtttttcttgccaatgcaactagacaaccaaggacaatgatggtcaaattgttccacacattgatcacatatagcacaatgttt |
51105409 |
T |
|
| Q |
101 |
cgtacgaagaggcctgataatcttgcatgttgcacaaatttgggaccaatttccagctagcaaagcaggattatttatcttatactgcaaaagaggctcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51105410 |
cgtacgaagaggcctgataatcttgcgtgttgcacaaatttgggaccaatttccagctagcaaagcaggattatttatcttatactgcaaaagaggctcg |
51105509 |
T |
|
| Q |
201 |
ttatctttaatattctgagt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
51105510 |
ttatctttaatattctgagt |
51105529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 51114862 - 51115025
Alignment:
| Q |
1 |
caaagaaatctcgtttgtttttcttgccaatgcaactagacaaccaaggacaatgatggtcaaattgttccacacattgatcacatatagcacaatgttt |
100 |
Q |
| |
|
||||||||||||||||||| || || ||||||||| | || | |||||||||||||||||||||||| ||||| |||||||| ||| ||||||||| |
|
|
| T |
51114862 |
caaagaaatctcgtttgttcttttttccaatgcaattggatacaataggacaatgatggtcaaattgttcaacacaacgatcacatgtagaacaatgttt |
51114961 |
T |
|
| Q |
101 |
cgtacgaagaggcctgataatcttgcatgttgcacaaatttgggaccaatttccagctagcaaa |
164 |
Q |
| |
|
|| |||||||||||| | |||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
51114962 |
cgcacgaagaggcctaacaatcttgcatgttgaacaaagttgggaccaatttccagctagcaaa |
51115025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 122 - 199
Target Start/End: Complemental strand, 48038379 - 48038302
Alignment:
| Q |
122 |
cttgcatgttgcacaaatttgggaccaatttccagctagcaaagcaggattatttatcttatactgcaaaagaggctc |
199 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| | || |||||||||||| |
|
|
| T |
48038379 |
cttgcatgttgcacaaagttgggaccaatttccagctagcaaagcaggattatttttctcaatcttcaaaagaggctc |
48038302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 23 - 123
Target Start/End: Complemental strand, 48038617 - 48038517
Alignment:
| Q |
23 |
cttgccaatgcaactagacaaccaaggacaatgatggtcaaattgttccacacattgatcacatatagcacaatgtttcgtacgaagaggcctgataatc |
122 |
Q |
| |
|
||||||||||||| | || | |||||||||||||||||||||||| |||||||| |||||||| ||| ||||||||| | ||||||||| |||| |||| |
|
|
| T |
48038617 |
cttgccaatgcaattggatacccaaggacaatgatggtcaaattgctccacacaacgatcacatgtagaacaatgttttgcacgaagaggtctgacaatc |
48038518 |
T |
|
| Q |
123 |
t |
123 |
Q |
| |
|
| |
|
|
| T |
48038517 |
t |
48038517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University