View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21117_low_11 (Length: 217)
Name: NF21117_low_11
Description: NF21117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21117_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 16 - 114
Target Start/End: Complemental strand, 27833874 - 27833776
Alignment:
| Q |
16 |
atatcttattcttggtattattatagttaagaggtgctaggagttctttcataacattgaattgcattgaatcctcagggctcatatccaccatggccg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27833874 |
atatcttattcttggtattattatagttaagaggtgctaggagttctttcataacattgaattgcattgaatcctcagggctcatatccaccatggccg |
27833776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University