View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21117_low_3 (Length: 378)
Name: NF21117_low_3
Description: NF21117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21117_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 233; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 16 - 359
Target Start/End: Complemental strand, 26834129 - 26833787
Alignment:
| Q |
16 |
attatgccacactggttttgtgaggccaggtctgcccctggttatttctattcttggcgcggcgtaagaccactccactacatggctatagtacgatgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26834129 |
attatgccacactggttttgtgaggccaggtctgcccctgattatttctattcttggcgcggcgtaagaccactccactacatggctatagtacgatgtt |
26834030 |
T |
|
| Q |
116 |
gactacataagttttagtttgctgcccnnnnnnnnnnnnnccttcacttgattttatcccgttgaatttttcaagcaaggttgttaatgaggtaatcagg |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26834029 |
gactacataagttttagtttgctgccctttttatttttttccttcacttgattttaccccgttgaatttttcaagcaaggttgttaatgaggtaatcagg |
26833930 |
T |
|
| Q |
216 |
ttttgtctttgcttccttagtttttgggctagtcttctaagtgtatccataatttcatttccatgtcttcnnnnnnnnnnnnnnnnnattggtcaagacc |
315 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26833929 |
ttttgtctgtgtttccttagtttttgggctagtcttctaagtgtatccataatttcatttccatgtcttc-ttgtttttttttttttattggtcaagacc |
26833831 |
T |
|
| Q |
316 |
atgtcttcttttttatttaattaataatatatcagggtgtcaac |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833830 |
atgtcttcttttttatttaattaataatatatcagggtgtcaac |
26833787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 201 - 285
Target Start/End: Complemental strand, 45418984 - 45418901
Alignment:
| Q |
201 |
aatgaggtaatcaggttttgtctttgcttccttagtttttgggctagtcttctaagtgtatccataatttcatttccatgtcttc |
285 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45418984 |
aatgaggtaatcaggttttgt-tttgcttccttagtttttgcgctactcttctaagtgtatccataattccatttccatgtcttc |
45418901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 314 - 353
Target Start/End: Complemental strand, 45418910 - 45418871
Alignment:
| Q |
314 |
ccatgtcttcttttttatttaattaataatatatcagggt |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45418910 |
ccatgtcttcttttttatttaattaataatatatcagggt |
45418871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University