View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21117_low_4 (Length: 351)
Name: NF21117_low_4
Description: NF21117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21117_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 14041462 - 14041627
Alignment:
| Q |
1 |
tatcaacaaacaaaaagtaaatggttggtactagacgatcaaaacactcatttctttcatatatcaagtcttctgagaagnnnnnnnntataaatatttc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
14041462 |
tatcaacaagcaaaaagtaaatggttggtactaggcgatcaaaacactcatttctttcatatatcaagtcttctgagatg-gaagatatataaatatttt |
14041560 |
T |
 |
| Q |
101 |
tctccatgacgacgatgatgatcatataataatgaaatttataacgagggtaatcttcaaagaatggttgtt |
172 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14041561 |
tctcaatgacgacgatgatg-----ataataattgaatttataacgagggtaatcttcaaagaatggttgtt |
14041627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 294 - 336
Target Start/End: Original strand, 14038706 - 14038748
Alignment:
| Q |
294 |
aaagagactagaaatgctttctttagtataggtaactagaaat |
336 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
14038706 |
aaagagactagaaaagcgttcttgagtataggtaactagaaat |
14038748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University