View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21118_low_5 (Length: 236)

Name: NF21118_low_5
Description: NF21118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21118_low_5
NF21118_low_5
[»] chr7 (1 HSPs)
chr7 (1-200)||(22881770-22881969)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 22881969 - 22881770
Alignment:
1 aaataaatgatgaaaaacagccggaagaaaataattggttcgatagttgtagaaccattgtggtaaccatgattccaaatcaaaacagttccaaaaccat 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
22881969 aaataaatgatgaaaaacagccggaagaaaataattggttagataattgtacaaccattgtggtaaccatgattccaaatcaaaacagttccaaaaccat 22881870  T
101 gtataaagtgttgctacctaaaaatttgaannnnnnngttgcagataaatgaacttggagataaatacatgtcaatggtgcattgaggataatggaactg 200  Q
    ||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||    
22881869 gtataaagtgttgctacctaaaaatttgaaattttttgttgcagataaatgaacttggagataaatacatgtcaatggtgccttgaggataatgaaactg 22881770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University