View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21119_high_28 (Length: 303)
Name: NF21119_high_28
Description: NF21119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21119_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 8 - 283
Target Start/End: Original strand, 11509518 - 11509793
Alignment:
| Q |
8 |
caccacagaacctctttctctgttagcaataccatcaattaccgaacacgctgttccatttccatggcaaatccaatcaaaacctaccatttatccaacc |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11509518 |
caccacagaacctctttctctgttaccaataccatcaattaccgaacacgctgttccatttccatggcaaatccaatcaaaacctaccatttatccaacc |
11509617 |
T |
|
| Q |
108 |
tcactcaaaccgaacttctctccctcaaatctcgtccacgcatcgatttctcttctgttttcgacattgtaacctttctctccccttttcatactcttcc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11509618 |
tcactcaaaccgaacttctctccctcaaatctcgtccacgcatcgatttctcttctgttttcgacattgtaacctttctctccccttttcatactcttcc |
11509717 |
T |
|
| Q |
208 |
tctaatgggtttttatttttcactctcaaaatcatacctttttgctttttcaggtcaaccccattgttgatgatgt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11509718 |
tctaatgggtttttatttttcactctcaaaatcatacctttttgctttttcaggtcaaccccattgttgatgatgt |
11509793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University