View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21119_high_5 (Length: 352)
Name: NF21119_high_5
Description: NF21119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21119_high_5 |
 | |
|
| [»] scaffold0356 (1 HSPs) |
| | |
|
| [»] scaffold0075 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0356 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: scaffold0356
Description:
Target: scaffold0356; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 10 - 332
Target Start/End: Original strand, 11261 - 11583
Alignment:
| Q |
10 |
gcaaaggcattcgatgcgttagattggaattttcttcttgcggtgcttcagcggtttagttttgatgaaaaatttgtgcattggattttggtgattttgc |
109 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11261 |
gcaaaggcattcgatacgttagattggaattttcttcttgcggtgcttcagcggtttggttttgatgaaaaatttgtgcattggattttggtgattttgc |
11360 |
T |
|
| Q |
110 |
aatccgctcgtttatcagtattggttaatgggaaggccgttgggttcttttcatgttcgcgtggtgtttgccaaggagacccattgtcaccgcttctttt |
209 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| | ||||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11361 |
aatccgctcgtttatcagtcttggttaatgggaaagccgttgggttctttacttgttcgcatggtgttcgccaaggagacccattgtcaccgcttctttt |
11460 |
T |
|
| Q |
210 |
ttgtctagctgaagaggttcttagtcgggctctttccatggctgcgactgatggacacctcattccattgtcctattgctgtggagtctctttccccact |
309 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
11461 |
ttgtctagttgaagaggttcttagtcgggcgctttccatggctgcgactgacggacaactcattccaatgtcctattgtcgtggagtatctttccccact |
11560 |
T |
|
| Q |
310 |
catattttatacgctgatgatgt |
332 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
11561 |
catattttatacgctgatgatgt |
11583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 13 - 332
Target Start/End: Original strand, 19739578 - 19739897
Alignment:
| Q |
13 |
aaggcattcgatgcgttagattggaattttcttcttgcggtgcttcagcggtttagttttgatgaaaaatttgtgcattggattttggtgattttgcaat |
112 |
Q |
| |
|
||||| |||||| | |||||||||||||| ||| || ||| |||| ||||||| ||||| |||||||| ||||||||||||| |||||||||||| ||| |
|
|
| T |
19739578 |
aaggctttcgataccttagattggaatttccttattttggttcttcggcggtttggttttcatgaaaaaattgtgcattggatcttggtgattttgaaat |
19739677 |
T |
|
| Q |
113 |
ccgctcgtttatcagtattggttaatgggaaggccgttgggttcttttcatgttcgcgtggtgtttgccaaggagacccattgtcaccgcttcttttttg |
212 |
Q |
| |
|
| || ||||||||||| |||||||||||||| || |||||||| ||||| || ||| |||| ||| | |||||| |||||||||| || ||||| || || |
|
|
| T |
19739678 |
cagcccgtttatcagtgttggttaatgggaaagctgttgggtttttttcttgctcgggtggggttcgacaaggacacccattgtcccctcttctcttctg |
19739777 |
T |
|
| Q |
213 |
tctagctgaagaggttcttagtcgggctctttccatggctgcgactgatggacacctcattccattgtcctattgctgtggagtctctttccccactcat |
312 |
Q |
| |
|
||| ||||||||||||||||||||||| || ||||| ||| | ||| |||| |||| ||| |||| ||||| |||| |||||| | |||||||| |
|
|
| T |
19739778 |
tctggctgaagaggttcttagtcgggcactctccattgcttcaactttcggacgactcacaccaatgtcttattgtcgtggggtctctcttcccactcag |
19739877 |
T |
|
| Q |
313 |
attttatacgctgatgatgt |
332 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
19739878 |
attttatacgctgacgatgt |
19739897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 240
Target Start/End: Complemental strand, 48800 - 48730
Alignment:
| Q |
170 |
gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct |
240 |
Q |
| |
|
|||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || |||||| |
|
|
| T |
48800 |
gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct |
48730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 227
Target Start/End: Complemental strand, 15144264 - 15144206
Alignment:
| Q |
169 |
cgtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggt |
227 |
Q |
| |
|
||||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| |
|
|
| T |
15144264 |
cgtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggt |
15144206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 170 - 240
Target Start/End: Complemental strand, 9077 - 9007
Alignment:
| Q |
170 |
gtggtgtttgccaaggagacccattgtcaccgcttcttttttgtctagctgaagaggttcttagtcgggct |
240 |
Q |
| |
|
|||||||| | ||||| ||||| ||||| || |||||||| ||||||||||||||||| || || |||||| |
|
|
| T |
9077 |
gtggtgttcgacaaggggaccccttgtccccccttcttttctgtctagctgaagaggtgctaagccgggct |
9007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 202 - 234
Target Start/End: Complemental strand, 8636245 - 8636213
Alignment:
| Q |
202 |
cttcttttttgtctagctgaagaggttcttagt |
234 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
8636245 |
cttcttttttgtttagctgaagaggttcttagt |
8636213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University