View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21119_high_7 (Length: 348)
Name: NF21119_high_7
Description: NF21119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21119_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 22 - 348
Target Start/End: Complemental strand, 6119318 - 6118992
Alignment:
| Q |
22 |
catcatcatcggtggaagaggttcaaacacagttgaattttacccgaaacgtgaaaatggtgtcgttttgtttccgtttctgcaagaaactgaagataca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6119318 |
catcatcatcggtggaagaggttcaaacacagttgaattttacccgaaacgcgaaaacggtgtcgttttgtttccgtttctacaagaaactgaagataca |
6119219 |
T |
 |
| Q |
122 |
caaatggataatttatacccgtatgttcatctccttcctaacggtaaccttttcgtgttcgcgaacacgaaatcgattatgtatgattttaacgaaaatc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6119218 |
caaatggataatttatacccgtatgttcatctccttcctaacggtaaacttttcgtgttcgcgaacacgaaatcggttatgtatgattttaacgaaaatc |
6119119 |
T |
 |
| Q |
222 |
gtgtggttcgggtttacccggagttaacgggtggaccgagaaattatccgtcggcggggagttcggtgatgcttgctttagaaggtgaattttcagaggc |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6119118 |
gtgtggttcgggtttacccggagttaacgggtggaccgagaaattatccgtcggcggggagttcggtgatgctggctttagaaggtgaattttcagaggc |
6119019 |
T |
 |
| Q |
322 |
ggtggttgttgtctgtggtgctgctca |
348 |
Q |
| |
|
|||||||||||| ||||| | |||||| |
|
|
| T |
6119018 |
ggtggttgttgtttgtggcggtgctca |
6118992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University