View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2111_low_14 (Length: 332)
Name: NF2111_low_14
Description: NF2111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2111_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 325
Target Start/End: Complemental strand, 3916456 - 3916161
Alignment:
| Q |
19 |
taagttctataaattggagtgattttggagacagtttattcatacaaacacaagagnnnnnnnnnnnnnnnnncttcaagagtaacttatatacactatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
3916456 |
taagttctataaattggagtgattttggagaaaatttattcatacaaacacgaga-----------aaaaaaacttcaagagtaacttatatacactatg |
3916368 |
T |
 |
| Q |
119 |
gcaaaacccatcactggttcacttgttttagttctccttgttacggcgattctgaacggacacaccgaagctgccggtagaggagctgaaccaccaaagg |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3916367 |
gcaaaaaccatcactggttcacttgttttagttctccttgttacggcgattctgaacggccacatcgaagctgccggtagaggagctgaaccaccaaagg |
3916268 |
T |
 |
| Q |
219 |
atggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgtttgttttg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3916267 |
atggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgtttgttttg |
3916168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 174
Target Start/End: Original strand, 5398543 - 5398604
Alignment:
| Q |
110 |
tacactatggcaaaacccatcactggttcacttgttttagttctccttgttacggcgattctgaa |
174 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
5398543 |
tacactatggcaaaatcca---ctgcttcacttgttttggttctccttgttgcggcgattttgaa |
5398604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University