View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2111_low_21 (Length: 247)
Name: NF2111_low_21
Description: NF2111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2111_low_21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 40353777 - 40353542
Alignment:
| Q |
12 |
agatgaaagcaaatcatggtcttctttattactttatctagaagatattcatacaatgtgaccaagatgaataccgagtctcaaacctacacaacttttg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40353777 |
agatgaaagcaaatcatggtcttctttattactttatcaagaagatattcatacaatgtgaccaagatgaatgccgagtctcaaacctacacaacttttg |
40353678 |
T |
|
| Q |
112 |
tatttacaacactctaaagatcaaaaaggtaaatttgtcactgctgtttttggacacagttatgggtaatttgagtaacataaatatgatctattatccg |
211 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40353677 |
tatttacaacactctaaagaacaaaaaggtaaatttgtcactgctgtttttggacacagttatgtgtaatttgagtaacataaatatgatctattatcca |
40353578 |
T |
|
| Q |
212 |
ataatgttgagtaagataatgatagaccaaggtgtg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40353577 |
ataatgttgagtaagataatgatagaccaaggtgtg |
40353542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University