View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_high_102 (Length: 226)
Name: NF21120_high_102
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_high_102 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 6171880 - 6172064
Alignment:
| Q |
18 |
atgagggtctaaatgatttttggttcactatggatatcacctattcattgccgttgatatattataaaatattaagtgttgcctattttataatatatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6171880 |
atgagggtctaaatgatttttggttcactatggatatcacctattcattgccgttgatatattataaaatattaagtgttgcctattttataatatatca |
6171979 |
T |
 |
| Q |
118 |
acgaatattgaaagttgatgcattttgaatcaaaattcatttgcatcatactctatgttaccttactttcttgtaatgtatagaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
6171980 |
acgaatattgaaagttgatgcattttgaatcaaaattcatttgcatcatactctatgtcaccttactttcctgtaatgtatagaa |
6172064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University