View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_high_104 (Length: 223)
Name: NF21120_high_104
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_high_104 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 54083785 - 54083972
Alignment:
| Q |
18 |
gagatgagctgtctacacaaaggatcactgatatatttttaaatttgaaactgagcaaaaataccaaaccatacctttgtagcaccgacactcctgatta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| | |||| |
|
|
| T |
54083785 |
gagatgagctgtctacacaaaggatcactgatatatttttaaatttgaaaatgagcaaaaaaaccaaaccatacctttgtagcaccgacacttttaatta |
54083884 |
T |
|
| Q |
118 |
aagacgtgattagtgttcaacacatatcaatgtctaaaaccaacatatgtggttttatatatcagtaatcagtgttaatgtcgtgtct |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54083885 |
aagacgtgattaatgttcaacacatatcaatttctaaaaccgacacgtgtggttttatatatcagtaatcagtgttaatgtcgtgtct |
54083972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 140
Target Start/End: Complemental strand, 7894800 - 7894751
Alignment:
| Q |
91 |
cctttgtagcaccgacactcctgattaaagacgtgattagtgttcaacac |
140 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
7894800 |
cctttgtagcaccgacacttctgatgaaagacgtgtctagtgttcaacac |
7894751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University