View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_high_108 (Length: 210)
Name: NF21120_high_108
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_high_108 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 11 - 107
Target Start/End: Original strand, 30158929 - 30159025
Alignment:
| Q |
11 |
tgagatgaaattgtccgaggagaatcgacgaaggtcgccgagattatcaggtgaatctgacggaagaggctcttcttcttgttctgttaaggtgtgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30158929 |
tgagatgaaattgtccgaggagaatcgacgaaggtcgccgagattatcaggtgaatctgacggaagaggctcttcttcttgttctgttaaggtgtgt |
30159025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University