View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_high_46 (Length: 377)
Name: NF21120_high_46
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_high_46 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 2e-62; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 10103094 - 10102969
Alignment:
| Q |
1 |
aaagaagtttgttcattttaagaacaaattaatgaataatattacctcttggatagttggtaaaaattcttctgctggatgataaagtacaacttcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10103094 |
aaagaagtttgttcattttaagaacaaattaatgaataatattacctcttggattgttggtaaaaattcttctgctggatgataaagtacaacttcatta |
10102995 |
T |
|
| Q |
101 |
ccctaaaatacattatgagacgttaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10102994 |
ccctaaaatacattatgagacgttaa |
10102969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 251 - 362
Target Start/End: Complemental strand, 10102543 - 10102432
Alignment:
| Q |
251 |
gcttgtaaaccttttcatcaacaccctttgtttgatgattcttatcatgatacttggaagaccccagtgaagttgatatgtccattccatggcttccagc |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10102543 |
gcttgtaaaccttttcatcaacaccctttgtttgatgattcttatcatgatacttggaagaccccagtgaagttgatatgtccattccatggcttccagc |
10102444 |
T |
|
| Q |
351 |
atagtaaatatt |
362 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10102443 |
atagtaaatatt |
10102432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 130 - 195
Target Start/End: Complemental strand, 10102663 - 10102598
Alignment:
| Q |
130 |
ttatccttattgttatgtatgtctcaaacaagattgttctgataataagagaaatgtgaatttcat |
195 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10102663 |
ttattcttattgttatgtatgtctcaaacaagattgttatgataataagagaaatgtgaatttcat |
10102598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University