View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21120_high_84 (Length: 259)

Name: NF21120_high_84
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21120_high_84
NF21120_high_84
[»] chr4 (2 HSPs)
chr4 (120-233)||(29758725-29758840)
chr4 (1-58)||(29758903-29758960)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 120 - 233
Target Start/End: Complemental strand, 29758840 - 29758725
Alignment:
120 ggcaaatgttaataattaatgattgtgttagttttaaaaatcaaacccgaagtctcttacttaaaattctttta--gtgtttaggctcaccaactaagat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||  |||||||||||||| |||||||||    
29758840 ggcaaatgttaataattaatgattgtgttagttttaaaaatcaaacccgaaatctcttacttaaaattcttttaatgtgtttaggctcactaactaagat 29758741  T
218 gcctatgtggaacata 233  Q
    ||||||||||||||||    
29758740 gcctatgtggaacata 29758725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 29758960 - 29758903
Alignment:
1 tattaaatgtggccacatgaaatgccaattgtgtttccactttactcttctgtcagag 58  Q
    |||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||    
29758960 tattaaatgtggccacataaaatgccaactgtgtttccactttactcttctgtcagag 29758903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University