View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_high_92 (Length: 241)
Name: NF21120_high_92
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_high_92 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 114 - 232
Target Start/End: Original strand, 33484305 - 33484426
Alignment:
| Q |
114 |
ttggttacgaaattggatttctaacaaaactgttgattgattggagatgttgtggcttgtgtgtttggaagcgttgcctttgttgatctcaagttctagt |
213 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33484305 |
ttggttacgaatttgggtttctaacaaaactgttgattgattggagatgttgtggcttgtgtgattggaagcgttacctttgttgatctcaagttctagt |
33484404 |
T |
|
| Q |
214 |
ttg---tcattgtgagttcatt |
232 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
33484405 |
ttgatttcattgtgagttcatt |
33484426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 17 - 107
Target Start/End: Original strand, 33484177 - 33484267
Alignment:
| Q |
17 |
aataattgggagggaattgaaaatgtggatttcacagaaaatgacttttccaactcagcaatttaattagctctcaaatctgtgagtcatc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33484177 |
aataattgggagggaattgaaaatgtggatttcacagtaaatgacttttccaactcaacaatttaattagctctcaaatctgtgagtcatc |
33484267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University