View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_107 (Length: 218)
Name: NF21120_low_107
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_107 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 49 - 194
Target Start/End: Complemental strand, 52345051 - 52344906
Alignment:
| Q |
49 |
tcagttggctggatccggccttgtaggttaagtacagtgttttgcaatcaaaatatgtgtaaaaaatttgatgaagtcaaaaaattatttgataagatat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52345051 |
tcagttggctggatccggccttgtaggttaagtacagtgttttgcaatcaaaatatgtgtaaaaaatttgatgaagtcaaaaaattatttgataagatat |
52344952 |
T |
 |
| Q |
149 |
acagctataacatttgcaattgcactttgcaagtcttcacatatat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52344951 |
acagctataacatttgcaattgcactttgcaagtcttcacatatat |
52344906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 48
Target Start/End: Complemental strand, 52345123 - 52345083
Alignment:
| Q |
8 |
aggagcagagaccaataaagatgagaaattcaagcattgta |
48 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52345123 |
aggatcagaaaccaataaagatgagaaattcaagcattgta |
52345083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University