View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_108 (Length: 214)
Name: NF21120_low_108
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 916041 - 916224
Alignment:
| Q |
18 |
gaagttgacctcgtactgtgtttgtttgatgaagacaactcagttgaccttctcctgagtatctgtctcataccatcagcaacacaaactgcaggatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
916041 |
gaagttgacctcgtactgtgtttgtttgatgaagacaactcagttgaccttctcctgagtatctgtctcataccatcagcaacacaaactgcaggatttg |
916140 |
T |
 |
| Q |
118 |
atttaatcttgcgacagaacaacatgtgagcttttattgcttcttccattgcaaatgtctttttccctctaatagcttcatctc |
201 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
916141 |
atttaatcttacgacagaacaacatgtgagcttttattgcttcttccattgcaaatgtctttttccctctaatagcttcatctc |
916224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University