View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_111 (Length: 208)
Name: NF21120_low_111
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_111 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 39946150 - 39945962
Alignment:
| Q |
1 |
gaaagtgttgtgtagactgtaggcaaccttttctacttttaacttagatcatcactctgaatgtgatttctaaaagggctttagtatactttcctcgtct |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39946150 |
gaaagtgttgtgtagcctgtaggcaaccttttctacttttaacttagatcatcactctgaatgtgatttctaaaagggttttagtatactttcctcgtct |
39946051 |
T |
|
| Q |
101 |
ttgtgttataatggtgcaagtatttctcatgtaggttactgatttcaatctcctgtatcaacttatgttatcaccttgttcgtggccta |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39946050 |
ttgtgttataatggtgcaagtatttctcatgtaggttactgatttcaatctcctgtatcaacttattttatcaccttgttcgtggccta |
39945962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University