View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21120_low_52 (Length: 352)
Name: NF21120_low_52
Description: NF21120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21120_low_52 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 4e-63; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 113 - 242
Target Start/End: Original strand, 4144151 - 4144281
Alignment:
| Q |
113 |
cttcttcttctagttgttgtatgcgaattgcaaatttatactctgttaaataacaagtttcaatttaaattttgaaatattttaggggttaagtaagtgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4144151 |
cttcttcttctagttgttgtatgcgaattgcaaatttatactctgttaaataacaagtttcaatttaaattttgaaatattttaggggttaagtaagtgt |
4144250 |
T |
 |
| Q |
213 |
ta-tttcttttttgaaggagggttaaataag |
242 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |
|
|
| T |
4144251 |
tattttcttttttgaaggagggttaaataag |
4144281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 4144053 - 4144107
Alignment:
| Q |
18 |
caaaaaacatacctatttataggtatgttaagctttcctttcctttaactctcga |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4144053 |
caaaaaacatacctatttataggtatgttaagttttcctttcctttaactctcga |
4144107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 308 - 336
Target Start/End: Original strand, 4144347 - 4144375
Alignment:
| Q |
308 |
gttgtccctaatagttggtttatgttcat |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4144347 |
gttgtccctaatagttggtttatgttcat |
4144375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University